WormBase Tree Display for Variation: WBVar02152963
expand all nodes | collapse all nodes | view schema
| WBVar02152963 | Evidence | Paper_evidence | WBPaper00059750 | ||
|---|---|---|---|---|---|
| Name | Public_name | ju1799 | |||
| Sequence_details | SMap | S_parent | Sequence | F11C1 | |
| Flanking_sequences | gagaccattttctcatcaactattgctcaa | tagtgaacttttattttgttttagctgtta | |||
| Mapping_target | F11C1 | ||||
| Type_of_mutation | Insertion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Engineered_allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00047735 | Paper_evidence | WBPaper00059750 | ||
| Laboratory | CZ | ||||
| Corresponding_transgene | WBTransgene00026858 | ||||
| Production_method | CRISPR_Cas9 | ||||
| Expr_pattern | Expr14937 | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00008694 | |||
| Transcript | F11C1.5a.2 | ||||
| F11C1.5a.1 | |||||
| Reference | WBPaper00059750 | ||||
| Remark | [2020-06-08T01:13:47.161Z WBPerson712] New Variation: WBPaper00059750 VWA-8, we generated a GFP knock-in allele, ju1799, in which GFP was in-frame fused at the C terminus to label the full-length protein specifically. | Curator_confirmed | WBPerson712 | ||
| [2020-06-08T01:14:00.107Z WBPerson712] Update Variation: | Curator_confirmed | WBPerson712 | |||
| Method | Engineered_allele |
