WormBase Tree Display for Variation: WBVar02153265
expand all nodes | collapse all nodes | view schema
WBVar02153265 | Name | Public_name | amt1 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE54335:p.Val2GlnfsTer8 | |||||||
D2092.1a.1:c.4_223del | ||||||||
D2092.1b.1:c.361-183_481del | ||||||||
D2092.1c.1:c.241-183_361del | ||||||||
HGVSg | CHROMOSOME_I:g.6633185_6633488del | |||||||
Sequence_details | SMap | S_parent | Sequence | ZC581 | ||||
Flanking_sequences | ttcattttcaaaacggttgacgcaaatatg | caggttttcttttttacttttattaataat | ||||||
Mapping_target | D2092 | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Engineered_allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00048141 | Paper_evidence | WBPaper00059962 | |||||
WBStrain00048142 | Paper_evidence | WBPaper00059962 | ||||||
WBStrain00048144 | Paper_evidence | WBPaper00059962 | ||||||
Laboratory | AMT | |||||||
Production_method | CRISPR_Cas9 | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00017063 | ||||||
Transcript | D2092.1a.1 (11) | |||||||
D2092.1c.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | D2092.1c.1:c.241-183_361del | |||||||
cDNA_position | ?-363 | |||||||
CDS_position | ?-361 | |||||||
Protein_position | ?-121 | |||||||
Intron_number | 4/15 | |||||||
Exon_number | 5/16 | |||||||
D2092.1b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | D2092.1b.1:c.361-183_481del | |||||||
cDNA_position | ?-481 | |||||||
CDS_position | ?-481 | |||||||
Protein_position | ?-161 | |||||||
Intron_number | 3/14 | |||||||
Exon_number | 4/15 | |||||||
Possibly_affects | WBGene00017063 | Paper_evidence | WBPaper00059962 | |||||
Remark | CGC_name mctp-1 | |||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00059962 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Less eggs laid. | Paper_evidence | WBPaper00059962 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000017 | Paper_evidence | WBPaper00059962 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Animals become paralyzed at a lower rate than the wild type animals. | Paper_evidence | WBPaper00059962 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Animals exposed to 1mM aldicarb. | Paper_evidence | WBPaper00059962 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000273 | Paper_evidence | WBPaper00059962 | ||||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001073 | Paper_evidence | WBPaper00059962 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | In the absence of food, mctp-1 (amt1) mutant animals laid a reduced number of eggs per hour than wild type hermaphrodites did. | Paper_evidence | WBPaper00059962 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0002326 | Paper_evidence | WBPaper00059962 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | mctp-1(amt1) mutant animals crawl at a significantly slower velocities than wild type animals. | Paper_evidence | WBPaper00059962 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_not_observed | WBPhenotype:0000845 | Paper_evidence | WBPaper00059962 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Animals exposed to 0.4mM levamisole. | Paper_evidence | WBPaper00059962 | ||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00059962 | |||||||
Remark | [2021-02-02T17:36:42.606Z WBPerson1983] New Variation: WBPaper00059962 mctp-1 3.3. mctp-1(amt1) is a loss of function CRISPR alleleTo gain some insight on MCTP-1 function, we generated the mctp-1(amt1) mutant by CRISPR/Cas9. We inserted the CRISPR cassette to delete a 304 base pair region between the first codon of exon five and the last codon of exon six of the mctp-1 locus (Figs. 1A and S1A-A). | Curator_confirmed | WBPerson1983 | |||||
[2021-02-02T17:36:42.606Z WBPerson1983] New Variation: WBPaper00059962 mctp-1 3.3. mctp-1(amt1) is a loss of function CRISPR alleleTo gain some insight on MCTP-1 function, we generated themctp-1(amt1)mutant by CRISPR/Cas9. We inserted the CRISPR cassette todelete a 304 base pair region between thefirst codon of exonfive andthe last codon of exon six of themctp-1locus (Figs. 1A and S1A-A). | Curator_confirmed | WBPerson1983 | ||||||
Method | Engineered_allele |