WormBase Tree Display for Variation: WBVar02153378
expand all nodes | collapse all nodes | view schema
WBVar02153378 | Evidence | Person_evidence | WBPerson8908 | ||
---|---|---|---|---|---|
Name | Public_name | ulv12 | |||
Other_name | F27D9.1a.1:c.104_110del | ||||
CE24927:p.Leu36CysfsTer24 | |||||
HGVSg | CHROMOSOME_X:g.7683099_7683105del | ||||
Sequence_details | SMap | S_parent | Sequence | F27D9 | |
Flanking_sequences | gtagcgcgtggaatgttctcatcgttgaca | catgcggatgttgtcatcctgctgcaaaat | |||
Mapping_target | F27D9 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00048381 | ||||
Component_of_genotype | WBGenotype00000054 | ||||
WBGenotype00000055 | |||||
WBGenotype00000056 | |||||
WBGenotype00000057 | |||||
WBGenotype00000058 | |||||
WBGenotype00000059 | |||||
WBGenotype00000060 | |||||
WBGenotype00000061 | |||||
WBGenotype00000062 | |||||
Laboratory | AMG | ||||
Person | WBPerson8908 | ||||
Production_method | CRISPR_Cas9 | ||||
Status | Live | ||||
Affects (2) | |||||
Description | Phenotype | WBPhenotype:0000019 | Paper_evidence | WBPaper00059359 | |
Curator_confirmed | WBPerson8908 | ||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00059359 | |||
Curator_confirmed | WBPerson8908 | ||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00059359 | |||
Curator_confirmed | WBPerson8908 | ||||
Disease_info (2) | |||||
Reference | WBPaper00059359 | ||||
Remark | deletion of 7 bp results in a frameshift and premature stop codon | Paper_evidence | WBPaper00059359 | ||
Person_evidence | WBPerson8908 | ||||
Curator_confirmed | WBPerson51134 | ||||
Variation information submitted by WBPerson8908 on 2021-05-24_04:54:56 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
Variation stub generated from the April 2021 NN VFP dataset. | |||||
Method | Engineered_allele |