WormBase Tree Display for Variation: WBVar02153481

WBVar02153481 Evidence: Person_evidence: WBPerson621
  Name: Public_name: tn1791
    Other_name: CE27419:p.Glu350Lys
      ZK792.2.1:c.1048G>A
    HGVSg: CHROMOSOME_IV:g.11675263G>A
  Sequence_details: SMap: S_parent: Sequence: ZK792
    Flanking_sequences: gtcaaatctcagagtgacttggtagcatcg aggttgccgtggagatgtacagcgactttt
    Mapping_target: ZK792
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00048690
    Laboratory: DG
    Status: Live
  Affects: Gene: WBGene00002130
    Transcript: ZK792.2.1 (12)
  Isolation: Mutagen: EMS
    Forward_genetics: Suppressor screen
  Genetics: Interpolated_map_position: IV 5.15683
  Reference: WBPaper00060791
  Remark: Generated from papers flagged positive during the last month for data type afp_variation/other_variation.
    alt_det = GAG changed to AAG mut_det = E350K Paper_evidence: WBPaper00060791
      Person_evidence: WBPerson621
      Curator_confirmed: WBPerson51134
    Variation information submitted by WBPerson621 on 2021-04-21_16:30:49 via the Allele submission form. Curator_confirmed: WBPerson51134
  Method: Substitution_allele