WormBase Tree Display for Variation: WBVar02154137
expand all nodes | collapse all nodes | view schema
WBVar02154137 | Evidence | Curator_confirmed | WBPerson1983 | ||
---|---|---|---|---|---|
Name | Public_name | ve561 | |||
Other_name | B0361.8.1:c.109_*94del | ||||
HGVSg | CHROMOSOME_III:g.7287863_7290440del | ||||
Sequence_details | SMap | S_parent | Sequence | B0361 | |
Flanking_sequences | cgatcagtttgaaatccataggaaagtttc | gaatccagaataaaggctgaatggtataat | |||
Mapping_target | B0361 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Engineered_allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00047467 | ||||
Production_method | CRISPR_Cas9 | ||||
Status | Live | ||||
Affects | Gene | WBGene00015162 | |||
Transcript | B0361.8.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
HGVSc | B0361.8.1:c.109_*94del | ||||
cDNA_position | 123-1521 | ||||
CDS_position | 109-? | ||||
Protein_position | 37-? | ||||
Intron_number | 2-9/10 | ||||
Exon_number | 2-11/11 | ||||
Remark | Whole gene deletions made by the Rougvie, Moerman, Hutter and Sternberg labs that replace the coding sequence with a [LoxP + myo-2p::GFP::unc-54 3Prime UTR + rps-27p::neoR::unc-54 3Prime UTR + LoxP] cassette. | ||||
Allele Description:+/mT1[umnIs52] II; algn-11(ve561[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III | |||||
Method | Engineered_allele |