WormBase Tree Display for Variation: WBVar02154205
expand all nodes | collapse all nodes | view schema
WBVar02154205 | Evidence | Curator_confirmed | WBPerson1983 | ||
---|---|---|---|---|---|
Name | Public_name | ve647 | |||
HGVSg | CHROMOSOME_II:g.6734836_6735950del | ||||
Sequence_details | SMap | S_parent | Sequence | T14B4 | |
Flanking_sequences | aaccaatgctgatgaaatcaacttccacgg | gatgggtagacagaagaaagattagaatta | |||
Mapping_target | T14B4 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Engineered_allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00049386 | ||||
Production_method | CRISPR_Cas9 | ||||
Status | Live | ||||
Affects | Gene | WBGene00020500 | |||
Transcript | T14B4.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
cDNA_position | ?-879 | ||||
CDS_position | ?-866 | ||||
Protein_position | ?-289 | ||||
Intron_number | 2-4/5 | ||||
Exon_number | 1-5/6 | ||||
Remark | Whole gene deletions made by the Rougvie, Moerman, Hutter and Sternberg labs that replace the coding sequence with a [LoxP + myo-2p::GFP::unc-54 3Prime UTR + rps-27p::neoR::unc-54 3Prime UTR + LoxP] cassette. | ||||
Allele Description:T14B4.3(ve647[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | |||||
sgRNA1:caagagaacttgaaactccg sgRNA2: GATCCTGGTTCGACTATCGA | |||||
Method | Engineered_allele |