WormBase Tree Display for Variation: WBVar02154248
expand all nodes | collapse all nodes | view schema
| WBVar02154248 | Evidence | Curator_confirmed | WBPerson1983 | ||
|---|---|---|---|---|---|
| Name | Public_name | ve690 | |||
| Sequence_details | SMap | S_parent | Sequence | Y54H5A | |
| Flanking_sequences | cacttgcagtttccgcttgatcacccaaat | cccgggtacgcgtccttctcaccgacaaac | |||
| Mapping_target | Y54H5A | ||||
| Type_of_mutation | Deletion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Engineered_allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00049429 | ||||
| Production_method | CRISPR_Cas9 | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00174448 | |||
| WBGene00305827 | |||||
| WBGene00021900 | |||||
| Transcript | Y54H5A.2.1 | ||||
| Y54H5A.6 | |||||
| Y54H5A.7 | |||||
| Remark | Whole gene deletions made by the Rougvie, Moerman, Hutter and Sternberg labs that replace the coding sequence with a [LoxP + myo-2p::GFP::unc-54 3Prime UTR + rps-27p::neoR::unc-54 3Prime UTR + LoxP] cassette. | ||||
| Allele Description:Y54H5A.2(ve690[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. | |||||
| sgRNA1:ccgcttgatcacccaaatta sgRNA2: gtatacctcattcgcccacc | |||||
| Method | Engineered_allele |
