WormBase Tree Display for Variation: WBVar02157860
expand all nodes | collapse all nodes | view schema
| WBVar02157860 | Evidence | Person_evidence | WBPerson13155 | ||
|---|---|---|---|---|---|
| Name | Public_name | cdb187 | |||
| HGVSg | CHROMOSOME_I:g.15036113_15040625delinsCTACCATAGGCACCACGAGCGG | ||||
| Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_I | |
| Flanking_sequences | aaagaaccgattttcttcctaaatccagct | gttcaacagagaatggagtgtcgacggcga | |||
| Mapping_target | F31C3 | ||||
| Type_of_mutation | Insertion | GCTACCATAGGCACCACGAGCGG | |||
| Deletion | |||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00051759 | ||||
| Laboratory | MCJ | ||||
| Production_method | CRISPR_Cas9 | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00001072 | |||
| WBGene00000881 | |||||
| WBGene00009284 | |||||
| Transcript | F31C3.2b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,3_prime_UTR_variant,intron_variant | ||
| VEP_impact | HIGH | ||||
| cDNA_position | 104-? | ||||
| Intron_number | 1-11/12 | ||||
| Exon_number | 1-13/13 | ||||
| F31C3.1.1 | VEP_consequence | coding_sequence_variant,3_prime_UTR_variant | |||
| VEP_impact | MODIFIER | ||||
| cDNA_position | 601-? | ||||
| CDS_position | 599-? | ||||
| Protein_position | 200-? | ||||
| Exon_number | 3-4/4 | ||||
| F31C3.2a.1 | VEP_consequence | transcript_ablation | |||
| VEP_impact | HIGH | ||||
| Intron_number | 2-10/11 | ||||
| Exon_number | 1-12/12 | ||||
| F31C3.2b.2 | VEP_consequence | transcript_ablation | |||
| VEP_impact | HIGH | ||||
| Intron_number | 2-10/11 | ||||
| Exon_number | 1-12/12 | ||||
| Genetics | Interpolated_map_position | I | 29.7377 | ||
| Reference | WBPaper00061983 | ||||
| Remark | deletion of entire ORF and introduction of cleavage site for dpy-10 gRNA | ||||
| Variation stub/paper connection generated from the April 2022 NN VFP dataset. | Curator_confirmed | WBPerson51134 | |||
| ccataaaagaaccgattttcttcctaaatccagct:GCTACCATAGGCACCACGAGCGG:gttcaacagagaatggagtgtcgacggcgatgtgt | Paper_evidence | WBPaper00061983 | |||
| Person_evidence | WBPerson13155 | ||||
| Curator_confirmed | WBPerson51134 | ||||
| alt_det = Replacement of entire ORF with 23-mer cleavage site of an efficient guide RNA for subsequent rounds of CRISPR | Paper_evidence | WBPaper00061983 | |||
| Person_evidence | WBPerson13155 | ||||
| Curator_confirmed | WBPerson51134 | ||||
| Variation information submitted by WBPerson13155 on 2023-06-12_13:06:00 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
| Method | Deletion_and_insertion_allele |
