WormBase Tree Display for Variation: WBVar02157906
expand all nodes | collapse all nodes | view schema
| WBVar02157906 | Evidence | Person_evidence | WBPerson31852 | |||||
|---|---|---|---|---|---|---|---|---|
| Name | Public_name | bn133 | ||||||
| Other_name | CE01711:p.MetSerArgProLeuGlyPheIleGlyTyrGluPheGlyAspAspGluMetPheValGlnGlnMetIleGluLysLysSerAsnAlaGluGlnAlaLysMetLeuGlyTrpTyrTyrIleValGluLysLysAspSerSerAsnPheLysTyrPheGlnAsnAsnArgLysArgCysSerAsnAlaProLysGlnCysGlnLysLysValSerGlnPheGlnTerAsnValSerIleLeuLysLysHisPheLysAlaAsnGlnTyrGlnLysValThrAsnArgHisThrArgIlePheArgPheSerArgLysMetLeuTerLeuLeuIleValArgIleHisIleValProTyrSerPheGlnPheLeuThrPheSerAsnGluProLeuProSerArgArgTyrArgGlnAlaHisProLysHisSerLysLeuGlyValHisSerTrpAsnArgArgSerSerProValProThrTrpLysValAlaGlnArgAlaGluThrHisTrpLeuGlyPheSerGluIlePheAlaAlaAsnThrThrGluLysCysSerGlyArgAsnAspArgLysProValTer1_?162 | |||||||
| ZK632.13a.1:c.1_486del | ||||||||
| HGVSg | CHROMOSOME_III:g.9824158_9824743del | |||||||
| Sequence_details | SMap | S_parent | Sequence | ZK632 | ||||
| Flanking_sequences | tcattattttttgatagaccactattcaat | ttttttcctgaaattaccgctatatgtcag | ||||||
| Mapping_target | ZK632 | |||||||
| Type_of_mutation | Insertion | |||||||
| Deletion | ||||||||
| SeqStatus | Sequenced | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00052698 | |||||||
| Production_method | CRISPR_Cas9 | |||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00003035 | ||||||
| Transcript | ZK632.13a.1 (11) | |||||||
| ZK632.13b.1 | VEP_consequence | transcript_ablation | ||||||
| VEP_impact | HIGH | |||||||
| cDNA_position | ?-366 | |||||||
| CDS_position | ?-366 | |||||||
| Protein_position | ?-122 | |||||||
| Intron_number | 1/1 | |||||||
| Exon_number | 1-2/2 | |||||||
| Possibly_affects | WBGene00003035 | Paper_evidence | WBPaper00064107 | |||||
| Remark | CGC_name lin-52 | |||||||
| Description | Phenotype | WBPhenotype:0000688 | Paper_evidence | WBPaper00064107 | ||||
| Curator_confirmed | WBPerson31852 | |||||||
| Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00064107 | ||||
| Curator_confirmed | WBPerson31852 | |||||||
| Reference | WBPaper00064107 | |||||||
| Remark | Variation information submitted by WBPerson31852 on 2022-08-18_08:33:44 via the Allele submission form. Submitted flanks match minus strand. | Curator_confirmed | WBPerson51134 | |||||
| TagRFP-T::3xFLAG replacement of lin-52 gene. TagRFP-T::3xFLAG generated from heat shock removal of the SEC in strain SS1240. | Person_evidence | WBPerson31852 | ||||||
| [2022-09-29T19:33:31.421Z WBPerson2987] New Variation: WBPaper00064107; allele of lin-52 | Curator_confirmed | WBPerson2987 | ||||||
| Method | Engineered_allele |
