WormBase Tree Display for Variation: WBVar02158262
expand all nodes | collapse all nodes | view schema
| WBVar02158262 | Evidence | Person_evidence | WBPerson31852 | ||
|---|---|---|---|---|---|
| Name | Public_name | bn132 | |||
| Other_name | CE01711:p.MetSerArgProLeuGlyPheIleGlyTyrGluPheGlyAspAspGluMetPheValGlnGlnMetIleGluLysLysSerAsnAlaGluGlnAlaLysMetLeuGlyTrpTyrTyrIleValGluLysLysAspSerSerAsnPheLysTyrPheGlnAsnAsnArgLysArgCysSerAsnAlaProLysGlnCysGlnLysLysValSerGlnPheGlnTerAsnValSerIleLeuLysLysHisPheLysAlaAsnGlnTyrGlnLysValThrAsnArgHisThrArgIlePheArgPheSerArgLysMetLeuTerLeuLeuIleValArgIleHisIleValProTyrSerPheGlnPheLeuThrPheSerAsnGluProLeuProSerArgArgTyrArgGlnAlaHisProLysHisSerLysLeuGlyValHisSerTrpAsnArgArgSerSerProValProThrTrpLysValAlaGlnArgAlaGluThrHisTrpLeuGlyPheSerGluIlePheAlaAlaAsnThrThrGluLysCysSerGlyArgAsnAspArgLysProValTer1_?162 | ||||
| ZK632.13a.1:c.1_486del | |||||
| HGVSg | CHROMOSOME_III:g.9824158_9824743del | ||||
| Sequence_details | SMap | S_parent | Sequence | ZK632 | |
| Flanking_sequences | tcattattttttgatagaccactattcaat | ttttttcctgaaattaccgctatatgtcag | |||
| Mapping_target | ZK632 | ||||
| Type_of_mutation | Insertion | ||||
| Deletion | |||||
| SeqStatus | Sequenced | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00052697 | ||||
| Production_method | CRISPR_Cas9 | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00003035 | |||
| Transcript | ZK632.13a.1 (11) | ||||
| ZK632.13b.1 | VEP_consequence | transcript_ablation | |||
| VEP_impact | HIGH | ||||
| cDNA_position | ?-366 | ||||
| CDS_position | ?-366 | ||||
| Protein_position | ?-122 | ||||
| Intron_number | 1/1 | ||||
| Exon_number | 1-2/2 | ||||
| Possibly_affects | WBGene00003035 | Remark | CGC_name lin-52 | ||
| Reference | WBPaper00064107 | ||||
| Remark | Variation information submitted by WBPerson31852 on 2022-08-18_08:30:55 via the Allele submission form. Submitted flanks match minus strand. | Curator_confirmed | WBPerson51134 | ||
| TagRFP-T^SEC^3xFLAG replacement of lin-52 gene. TagRFP-T^SEC^3xFLAG (From pDD284) replaced the entire lin-52 coding sequence | Person_evidence | WBPerson31852 | |||
| [2022-10-07T23:08:44.705Z WBPerson51134] New Variation: Variation information submitted by on 2022-08-18_08:30:55 via the Allele submission form. TagRFP-T^SEC^3xFLAG replacement of lin-52 gene. TagRFP-T^SEC^3xFLAG (From pDD284) replaced the entire lin-52 coding sequence | Curator_confirmed | WBPerson51134 | |||
| Method | Engineered_allele |
