WormBase Tree Display for Variation: WBVar02158263

WBVar02158263 Evidence: Person_evidence: WBPerson31852
  Name: Public_name: bn138
  Sequence_details: SMap: S_parent: Sequence: ZK632
    Flanking_sequences: ttattttttgatagaccactattcaattca ctggcttcctgtcgtttcttccgctacatt
    Mapping_target: ZK632
    Type_of_mutation: Insertion
    SeqStatus: Sequenced
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00052699
    Production_method: CRISPR_Cas9
    Status: Live
  Affects: Gene: WBGene00003035
    Transcript: ZK632.13a.1
      ZK632.13b.1
  Possibly_affects: WBGene00003035 Remark: CGC_name lin-52
  Reference: WBPaper00064107
  Remark: GFP^SEC^3xFLAG (From pDD282) inserted before the lin-52 stop codon. Curator_confirmed: WBPerson51134
    alt_det = C-terminal GFP^SEC^3xFLAG tag of lin-52 CDS Curator_confirmed: WBPerson51134
    Variation information submitted by WBPerson31852 on 2022-08-18_08:36:43 via the Allele submission form. Submitted flanks match minus strand. Curator_confirmed: WBPerson51134
    C-terminal GFP^SEC^3xFLAG tag of lin-52 CDS. GFP^SEC^3xFLAG (From pDD282) inserted before the lin-52 stop codon. Person_evidence: WBPerson31852
    [2022-10-07T23:35:30.48Z WBPerson51134] New Variation: Variation information submitted by WBPerson31852 on 2022-08-18_08:36:43 via the Allele submission form. lin-52 allele Curator_confirmed: WBPerson51134
  Method: Engineered_allele