WormBase Tree Display for Variation: WBVar02158265
expand all nodes | collapse all nodes | view schema
| WBVar02158265 | Evidence | Person_evidence | WBPerson31852 | ||
|---|---|---|---|---|---|
| Name | Public_name | bn150 | |||
| Sequence_details | SMap | S_parent | Sequence | ZK632 | |
| Flanking_sequences | tggctcactttcttctggcattgtttcggt | ttcgagcatctttttctgttgttctgaaaa | |||
| Mapping_target | ZK632 | ||||
| SeqStatus | Sequenced | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00052701 | ||||
| Production_method | CRISPR_Cas9 | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00003035 | |||
| Transcript | ZK632.13a.1 | ||||
| ZK632.13b.1 | |||||
| Possibly_affects | WBGene00003035 | Remark | CGC_name lin-52 | ||
| Reference | WBPaper00064107 | ||||
| Remark | mut_det = C44A | Curator_confirmed | WBPerson51134 | ||
| Variation information submitted by WBPerson31852 on 2022-08-18_08:43:31 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
| Complex Alteration. Missense C44A with silent mutations to create and XhoI restriction site. Single C44A mutation (1A) of C-terminal GFP-3xFLAG tagged lin-52 backcrossed 6x with N2. WT sequence: ATGCTCGAATGCACCGAAACA 1A sequence: ATGCTCGAGGCTACAGAAACA Additional silent mutations creating an XhoI restriction site were included to aid genotyping. | Person_evidence | WBPerson31852 | |||
| [2022-10-08T00:04:52.786Z WBPerson51134] New Variation: Variation information submitted by WBPerson31852 on 2022-08-18_08:43:31 via the Allele submission form. Complex Alteration. Missense C44A with silent mutations to create and XhoI restriction site. Single C44A mutation (1A) of C-terminal GFP-3xFLAG tagged lin-52 backcrossed 6x with N2. WT sequence: ATGCTCGAATGCACCGAAACA 1A sequence: ATGCTCGAGGCTACAGAAACA Additional silent mutations creating an XhoI restriction site were included to aid genotyping. | Curator_confirmed | WBPerson51134 | |||
| Method | Engineered_allele |
