WormBase Tree Display for Variation: WBVar02158494
expand all nodes | collapse all nodes | view schema
| WBVar02158494 | Evidence | Person_evidence | WBPerson23962 | ||
|---|---|---|---|---|---|
| Name | Public_name | syb2415 | |||
| Other_name | CE24758:p.Phe24_Ter174delextTer? | ||||
| 3R5.1a.1:c.70_522del | |||||
| 3R5.1b.1:c.70_510del | |||||
| CE47782:p.Phe24_Ter170delextTer? | |||||
| HGVSg | CHROMOSOME_III:g.13780297_13780796del | ||||
| Sequence_details | SMap | S_parent | Sequence | 3R5 | |
| Flanking_sequences | aaattccaagatgatcgatattataagctt | aatgttttgtacgatgaaaatttcatcgag | |||
| Mapping_target | 3R5 | ||||
| Type_of_mutation | Deletion | ||||
| SeqStatus | Sequenced | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00052786 | ||||
| Production_method | CRISPR_Cas9 | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00007065 | |||
| WBGene00305233 | |||||
| Transcript | 3R5.3 | ||||
| 3R5.1b.1 (11) | |||||
| 3R5.1a.1 (11) | |||||
| Possibly_affects | WBGene00007065 | Paper_evidence | WBPaper00064803 | ||
| Remark | CGC_name pot-3 | ||||
| Description | Phenotype | WBPhenotype:0000879 | Paper_evidence | WBPaper00064803 | |
| Curator_confirmed | WBPerson23962 | ||||
| Reference | WBPaper00064803 | ||||
| Remark | 500bp deletion spanning the OB-fold of POT-3 | Person_evidence | WBPerson23962 | ||
| Curator_confirmed | WBPerson51134 | ||||
| Variation information submitted by WBPerson23962 on 2023-04-6_04:30:02 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
| [2023-04-11T23:07:50.757Z WBPerson2987] New Variation: WBPaper00064803; we isolated a new null allele, pot-3(syb2415) which contains a 500 bp deletion spanning the entire OB fold (Figure 1A and Supplementary Figure S1). | Curator_confirmed | WBPerson2987 | |||
| Method | Engineered_allele |
