WormBase Tree Display for Expr_pattern: Expr5089
expand all nodes | collapse all nodes | view schema
Expr5089 | Expression_of | Gene | WBGene00004457 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00004457 | ||
Expression_data (2) | |||
Type | Reporter_gene | [rpm-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGCCTTCTGTTTATACAATTTGG] 3' and primer B 5' [GAACGAGATTTGGATATTCTTTGG] 3'. | |
Pattern | Adult Expression: pharynx; Nervous System; nerve ring; ventral nerve cord; neurons along body; tail neurons; unidentified cells; | ||
Larval Expression: Nervous System; nerve ring; ventral nerve cord; neurons along body; tail neurons; unidentified cells; | |||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. | ||
Strain: BC11397 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002578 |