WormBase Tree Display for Expr_pattern: Expr5110
expand all nodes | collapse all nodes | view schema
| Expr5110 | Expression_of | Gene | WBGene00015344 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00015344 | ||
| Homol | Homol_homol | K10C9:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term (18) | |||
| Type | Reporter_gene | [C02E11.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAAGGTCAAATTTTCGTCGATT] 3' and primer B 5' [TAAAGAACCGATGATCTGGAAAA] 3'. | |
| Pattern | Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; tail neurons; | ||
| Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | |||
| Picture | WBPicture0000009139 | ||
| WBPicture0000009140 | |||
| WBPicture0000009141 | |||
| Remark | Also expressed in (comments from author) : high intensity GFP, other tissues may be masked | ||
| Strain: BC12752 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00004382 |
