WormBase Tree Display for Expr_pattern: Expr5122
expand all nodes | collapse all nodes | view schema
| Expr5122 | Expression_of | Gene | WBGene00002202 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00002202 | ||
| Homol | Homol_homol | C03C10:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term (13) | |||
| Type | Reporter_gene | [C03C10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAAGTTTTCGTGAATCCTCCT] 3' and primer B 5' [ATTGTTTGCTCTGATCGTGCT] 3'. | |
| Pattern | Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells; | ||
| Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells; | |||
| Picture | WBPicture0000009153 | ||
| Remark | Also expressed in (comments from author) : High intensity GFP, therefore hard to distinguish some tissues... there might be excretory cell expression; the neural analysis carries some uncertainty. | ||
| Strain: BC10439 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002258 |
