WormBase Tree Display for Expr_pattern: Expr5292

Expr5292 Expression_of: Gene: WBGene00015926
    Reflects_endogenous_expression_of: WBGene00015926
  Homol: Homol_homol: C17H11:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term (13)
  Type: Reporter_gene: [C17H11.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTATTAAAAATGTTTGCGCCG] 3' and primer B 5' [CGTCGCTGTATGACCAACC] 3'.
  Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; Reproductive System; uterus; vulva other; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ;
    Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ;
  Picture: WBPicture0000003895
    WBPicture0000003896
    WBPicture0000003897
  Remark: Also expressed in (comments from author) : Neural in tail are the PHASMID GLIA i.e. socket cells (Hall Lab, 2005).
    Strain: BC13998
  Reference: WBPaper00006525
  Transgene: WBTransgene00003363