WormBase Tree Display for Expr_pattern: Expr5434
expand all nodes | collapse all nodes | view schema
| Expr5434 | Expression_of | Gene | WBGene00016448 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00016448 | ||
| Homol | Homol_homol | C35D10:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0003679 | ||
| WBbt:0005300 | |||
| WBbt:0005735 | |||
| WBbt:0006749 | |||
| WBbt:0006751 | |||
| WBbt:0006759 | |||
| Type | Reporter_gene | [C35D10.12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTCGTTTGAGCACGCA] 3' and primer B 5' [CCGAACTTATGCTGATACTGTTT] 3'. | |
| Pattern | Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; | ||
| Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; | |||
| Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
| Strain: BC12383 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002908 |
