WormBase Tree Display for Expr_pattern: Expr5580
expand all nodes | collapse all nodes | view schema
Expr5580 | Expression_of | Gene | WBGene00006852 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006852 | ||||
Homol | Homol_homol | C53D6:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005300 | ||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
Type | Reporter_gene | [unc-129::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGCAGCAGTTGTCACGAGT] 3' and primer B 5' [CCTGATTTTCTTGCTTGCTCTT] 3'. | |||
Pattern | Adult Expression: Nervous System; ventral nerve cord; unidentified cells in head; | ||||
Larval Expression: Nervous System; ventral nerve cord; unidentified cells in head; | |||||
Remark | Also expressed in (comments from author) : There is at least one bright cell near the terminal bulb. | ||||
Strain: BC11859 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002724 |