WormBase Tree Display for Expr_pattern: Expr5618
expand all nodes | collapse all nodes | view schema
Expr5618 | Expression_of | Gene | WBGene00017042 | Inferred_automatically | |
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00017042 | ||||
Homol | Homol_homol | D2007:Expr | |||
Expression_data | Life_stage (2) | ||||
Anatomy_term | WBbt:0005300 | ||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
WBbt:0006751 | |||||
WBbt:0006759 | |||||
Type | Reporter_gene | [D2007.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCAAACGGACATACATCAAA] 3' and primer B 5' [CAGCGATTGATCCTGAACATTA] 3'. | |||
Pattern | Adult Expression: intestine; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; | ||||
Larval Expression: intestine; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; | |||||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||||
Strain: BC12489 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002946 | ||||
Historical_gene | WBGene00017043 | Note: This object originally referred to WBGene00017043. WBGene00017043 is now considered dead and has been merged into WBGene00017042. WBGene00017042 has replaced WBGene00017043 accordingly. |