WormBase Tree Display for Expr_pattern: Expr5763
expand all nodes | collapse all nodes | view schema
Expr5763 | Expression_of | Gene | WBGene00004719 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00004719 | ||
Homol | Homol_homol | F15A2:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005300 | ||
WBbt:0005735 | |||
WBbt:0006749 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [sad-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACTTTGACCGGGTATTATGAAAAA] 3' and primer B 5' [ACTTTGCCCGATTGACGA] 3'. | |
Pattern | Adult Expression: Nervous System; nerve ring; ventral nerve cord; tail neurons; unidentified cells; | ||
Larval Expression: Nervous System; nerve ring; ventral nerve cord; tail neurons; unidentified cells; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC11135 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002503 |