WormBase Tree Display for Expr_pattern: Expr6009

Expr6009 Expression_of: Gene: WBGene00009587
    Reflects_endogenous_expression_of: WBGene00009587
  Homol: Homol_homol: F40F11:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term (20)
  Type: Reporter_gene: [F40F11.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCGCCATTAAGAAGTACAGTAAC] 3' and primer B 5' [TTGTTTCCGAATCATTATCTTGTT] 3'.
  Pattern: Adult Expression: pharynx; anal depressor muscle; Reproductive System; uterus; vulval muscle; vulva other; spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; unidentified cells in head; unidentified cells in tail ;
    Larval Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; developing uterus; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; unidentified cells in head; unidentified cells in tail ;
  Picture: WBPicture0000005158
    WBPicture0000005159
    WBPicture0000005160
    WBPicture0000005161
    WBPicture0000005162
    WBPicture0000005163
  Remark: Also expressed in (comments from author) : unidentified cells in head and tail, a lot of neural
    Strain: BC12753
  Reference: WBPaper00006525
  Transgene: WBTransgene00004468