Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6161

expand all nodes | collapse all nodes | view schema

Name Class

Expr6161Expression_ofGeneWBGene00000164
Reflects_endogenous_expression_ofWBGene00000164
HomolHomol_homolF53H8:Expr
Expression_data (2)
TypeReporter_gene[apt-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCCCCATTTTTCATTGTTTC] 3' and primer B 5' [CTGTTCAGCATAACTAAAATCCAA] 3'.
PatternAdult Expression: anal depressor muscle; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: anal depressor muscle; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC15406
ReferenceWBPaper00006525
TransgeneWBTransgene00003955