WormBase Tree Display for Expr_pattern: Expr6319

Expr6319 Expression_of: Gene: WBGene00000044
    Reflects_endogenous_expression_of: WBGene00000044
  Homol: Homol_homol: K03F8:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0003679
      WBbt:0005300
      WBbt:0005735
      WBbt:0005741 Partial
        Remark: unidentified cells
      WBbt:0006751
  Type: Reporter_gene: [acr-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATTCAGAGCCGACTTCCATAA] 3' and primer B 5' [GTTGGGAAGGATGCTGAAAA] 3'.
  Pattern: Adult Expression: Nervous System; head neurons; neurons along body; unidentified cells in tail ;
    Larval Expression: Nervous System; ventral nerve cord; head neurons; neurons along body; unidentified cells in tail ;
  Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated.
    Strain: BC11419
  Reference: WBPaper00006525
  Transgene: WBTransgene00002589