WormBase Tree Display for Expr_pattern: Expr6726

Expr6726 Expression_of: Gene: WBGene00011884
    Reflects_endogenous_expression_of: WBGene00011884
  Homol: Homol_homol: T21B10:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term (21)
  Type: Reporter_gene: [T21B10.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGCTCTACGCAAGTTATTTCAG] 3' and primer B 5' [TCTTGGTGATTGGGATCCTG] 3'.
  Pattern: Adult Expression: pharynx; intestine; rectal gland cells; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterine muscle; vulval muscle; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head;
    Larval Expression: pharynx; intestine; rectal gland cells; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; amphid socket cells; tail neurons; unidentified cells; unidentified cells in head;
  Picture: WBPicture0000006432
    WBPicture0000006433
    WBPicture0000006434
    WBPicture0000006435
    WBPicture0000006436
    WBPicture0000006437
  Remark: Also expressed in (comments from author) : Unidentified cells in head, are possibly nuclei of the nerve ring. And what we thought were arcade cells, may actually be the 2 amphid socket cells.
    Strain: BC11318
  Reference: WBPaper00006525
  Transgene: WBTransgene00002556