WormBase Tree Display for Expr_pattern: Expr6949
expand all nodes | collapse all nodes | view schema
| Expr6949 | Expression_of | Gene | WBGene00012665 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00012665 | ||
| Homol | Homol_homol | Y39B6A:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0005772 | ||
| Type | Reporter_gene | [Y39B6A.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACGCACATAAAAGTTGTACATGA] 3' and primer B 5' [AGGTCTGGATTACCTGGAAGAAG] 3'. | |
| Pattern | Adult Expression: intestine; | ||
| Larval Expression: intestine; | |||
| Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
| Strain: BC10795 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002392 |
