WormBase Tree Display for Expr_pattern: Expr7004
expand all nodes | collapse all nodes | view schema
| Expr7004 | Expression_of | Gene | WBGene00012985 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00012985 | ||
| Homol | Homol_homol | Y48C3A:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term (18) | |||
| Type | Reporter_gene | [Y48C3A.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAAAAGGAGGAAGAAGCGG] 3' and primer B 5' [GCCTTTGATAATTGGATTCTGA] 3'. | |
| Pattern | Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; | ||
| Larval Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; Reproductive System; developing uterus; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; | |||
| Picture | WBPicture0000006850 | ||
| Remark | Also expressed in (comments from author) : unidentified cells in head and tail, possibly neural | ||
| Strain: BC13333 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003141 |
