Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7107

expand all nodes | collapse all nodes | view schema

Name Class

Expr7107Expression_ofGeneWBGene00022114
Reflects_endogenous_expression_ofWBGene00022114
HomolHomol_homolY71F9AL:Expr
Expression_dataLife_stage (2)
Anatomy_term (12)
TypeReporter_gene[Y71F9AL.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAGGACACCAAAAAGTCAAA] 3' and primer B 5' [TTCCTTTGGTGCGATTTTTC] 3'.
PatternAdult Expression: pharynx; stomato-intestinal muscle; uterine muscle; vulval muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons;
Larval Expression: pharynx; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons;
RemarkStrain: BC15529
ReferenceWBPaper00006525
TransgeneWBTransgene00004006