WormBase Tree Display for Expr_pattern: Expr7121

Expr7121 Expression_of: Gene: WBGene00013529
    Reflects_endogenous_expression_of: WBGene00013529
  Homol: Homol_homol: Y73F8A:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0003679
      WBbt:0005300
      WBbt:0005735
      WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005741 Partial
        Remark: unidentified cells
      WBbt:0005772
      WBbt:0006751
  Type: Reporter_gene: [Y73F8A.24::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATCTCACGGGCTTTGCTT] 3' and primer B 5' [CGGATGAGATCTGGAAAAACA] 3'.
  Pattern: Adult Expression: intestine; Nervous System; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ;
    Larval Expression: intestine; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ;
  Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated.
    Strain: BC11661
  Reference: WBPaper00006525
  Transgene: WBTransgene00002650