WormBase Tree Display for Construct: WBCnstr00018110
expand all nodes | collapse all nodes | view schema
| WBCnstr00018110 | Summary | [Pkpc-1::KPC-1::dsRed] | |
|---|---|---|---|
| Driven_by_gene | WBGene00002232 | ||
| Gene | WBGene00002232 | ||
| Fusion_reporter | DsRed | ||
| Type_of_construct | Translational_fusion | ||
| Construction_summary | This transgene was created using PCR fusion with kpc-1 DNA amplified from fosmid WRM0635bG07, fluorophores amplified from a dsRed variant of pPD95.75, and the klp-6 promoter amplified from genomic DNA. Primers used include: Primer A: 5'agccttagggagtttgaggtg3'; Primer A*: 5'tgtatgctttagaggagaacgaaa3', Primer B: 5'agtcgacctgcaggcatgcaagctatgaagttgatataaaatctgggaaa3'; Primer C,D,D* as published (Hobert, 2002). | ||
| Used_for | Transgene_construct | WBTransgene00018748 | |
| Reference | WBPaper00044031 |
