WormBase Tree Display for Construct: WBCnstr00018228
expand all nodes | collapse all nodes | view schema
| WBCnstr00018228 | Summary | [Pklp-6::KPC-1] | |
|---|---|---|---|
| Driven_by_gene | WBGene00002218 | ||
| Gene | WBGene00002232 | ||
| Type_of_construct | Translational_fusion | ||
| Construction_summary | IL2-specific rescuing array. This transgene was created using PCR fusion with kpc-1 DNA amplified from fosmid WRM0635bG07, and the klp-6 promoter amplified from genomic DNA. Primer A: 5'tgaaatgccgcaaagactac3', Primer A*: 5'cgttttggagtttgctacga3'; Primer B:5'tgatatttgacatttttgcaaatttgagtcaccctttccgattattct3'; Primer C:5'aaatttgcaaaaatgtcaaatatca3'; Primer D:5'tgttctagcaccatcggaaa3'; Primer D*5'ggagtggggaaaagtgaaaa3'. | ||
| Used_for | Transgene_construct | WBTransgene00018867 | |
| WBTransgene00018868 | |||
| Reference | WBPaper00044031 |
