WormBase Tree Display for RNAi: WBRNAi00062889
expand all nodes | collapse all nodes | view schema
WBRNAi00062889 | Homol | Homol_homol | M79:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | tggcattgcatcttccttcaacgctttcactgcaattgtgcagtcatgtcgtttccagtatccctcgtacacgtctccgtactgtccaccgcccaatttgttatgcatgatgatttcggatctatctagttcccattcgtctggcgcgttaggcgacagtgagaacagtccacgtcccttgtcctttttactcgctgggtacattaaaagacatatcagcccatcagcgtgaacactatgatggtgcactaactctccaagtgtgcggaatttgacttcttgtgtgatgaacatctgtaaaaagcgagtatttgcacacttttgagttggttaaatacaataaaaatcacatgattgtggttgaggggttgatcagtgaaatcaagtataagtaaagctcaccttttctgtattatctacattgatccggtagtgaaacactcgaccatcatggcgaacagagattgtatactgtcctatacttgtttcactttctcgtaccaaaaatgagccagtgattccactgcctagtatagcctcagaatcgctccttgagattttgccatgataccacgtgtacttatccaaagagttgtacggagcaataaaattacttggcacccatccaatttcgcctaaccttcgctgattgctcgcatcattttttctcgttgagtataatcgtgcctcacaccactcattg | |||
Experiment | Laboratory | XR | |||
Date | 27 May 2004 00:00:00 | ||||
Treatment | worms exposed to ionizing radiation (120 Gy) | ||||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | M79.1a | Inferred_automatically | RNAi_primary | |
M79.1g | Inferred_automatically | RNAi_primary | |||
M79.1b | Inferred_automatically | RNAi_primary | |||
M79.1d | Inferred_automatically | RNAi_primary | |||
M79.1f | Inferred_automatically | RNAi_primary | |||
M79.1e | Inferred_automatically | RNAi_primary | |||
M79.1c | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00000018 | Inferred_automatically | RNAi_primary | ||
Transcript (7) | |||||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00024301 | ||||
Phenotype | WBPhenotype:0000731 | Remark | increased germ-cell apoptosis after exposure to ionizing radiation | ||
Remark | Germ-cell corpses were scored in F1 young adult worms 36 h after exposure to 120 Gy. | ||||
Method | RNAi |