WormBase Tree Display for RNAi: WBRNAi00062890
expand all nodes | collapse all nodes | view schema
WBRNAi00062890 | Homol | Homol_homol | M79:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | tggcattgcatcttccttcaacgctttcactgcaattgtgcagtcatgtcgtttccagtatccctcgtacacgtctccgtactgtccaccgcccaatttgttatgcatgatgatttcggatctatctagttcccattcgtctggcgcgttaggcgacagtgagaacagtccacgtcccttgtcctttttactcgctgggtacattaaaagacatatcagcccatcagcgtgaacactatgatggtgcactaactctccaagtgtgcggaatttgacttcttgtgtgatgaacatctgtaaaaagcgagtatttgcacacttttgagttggttaaatacaataaaaatcacatgattgtggttgaggggttgatcagtgaaatcaagtataagtaaagctcaccttttctgtattatctacattgatccggtagtgaaacactcgaccatcatggcgaacagagattgtatactgtcctatacttgtttcactttctcgtaccaaaaatgagccagtgattccactgcctagtatagcctcagaatcgctccttgagattttgccatgataccacgtgtacttatccaaagagttgtacggagcaataaaattacttggcacccatccaatttcgcctaaccttcgctgattgctcgcatcattttttctcgttgagtataatcgtgcctcacaccactcattg | |||
Experiment | Laboratory | XR | |||
Date | 27 May 2004 00:00:00 | ||||
Treatment | worms exposed to ionizing radiation (120 Gy) | ||||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene (7) | ||||
Gene | WBGene00000018 | Inferred_automatically | RNAi_primary | ||
Transcript | M79.1f.1 | Inferred_automatically | RNAi_primary | ||
M79.1c.1 | Inferred_automatically | RNAi_primary | |||
M79.1e.1 | Inferred_automatically | RNAi_primary | |||
M79.1d.1 | Inferred_automatically | RNAi_primary | |||
M79.1g.1 | Inferred_automatically | RNAi_primary | |||
M79.1a.1 | Inferred_automatically | RNAi_primary | |||
M79.1b.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00024301 | ||||
Phenotype | WBPhenotype:0000731 | Remark | increased germ-cell apoptosis after exposure to ionizing radiation | ||
Remark | Germ-cell corpses were counted in adult F1 progeny 24 h after exposure to 120 Gy. | ||||
Method | RNAi |