WormBase Tree Display for RNAi: WBRNAi00091265
expand all nodes | collapse all nodes | view schema
WBRNAi00091265 | Homol | Homol_homol | B0207:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | GCGCCAAACAATGTGCGGAACAATGGACTATCTCCCTCCTGAAATGGTGAATGGAGCCGATCACAGTGACGCAGTTGACTTATGGGCAATCGGCGTTCTCTGCTATGAGTTTCTCGTTGGAAAACCCCCATTCGAGCACGAAGATCAGTCCAAGACATATGCGGCAATCAAAGCGGCACGGTTTACTTACCCTGATTCTGTGAAGAAGGGTGCACGAGATTTGATTGGAAGATTGCTTGTCGTTGATCCCAAGGCTCGCTGTACGCTTGAACAGGTTTGTTATTGATTTCAGCTTAGTGGCCAACATATTATCAGCACACAGAAGTACACTTTTGTAGTGTTCTTAATTATCATAATTCATTAAATTATTACAGGTGAAGGAACACTACTGGATCCAGGGAATGATGGAGGCAAAAATTAGAGCTGAGAAGCAGCAAAAGATTGAAAAAGAA | |||
Experiment | Laboratory | CB | |||
Date | 22 Jan 1999 00:00:00 | ||||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | B0207.4 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00000099 | Inferred_automatically | RNAi_primary | ||
Transcript | B0207.4.1 | Inferred_automatically | RNAi_primary | ||
B0207.4.2 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00003548 | ||||
Phenotype (4) | |||||
Phenotype_not_observed | WBPhenotype:0001110 | Remark | In stu-7/air-2 (RNAi) embryos pronuclear fusion, centrosome duplication and rotation and the nucleation of bipolar microtubule spindle asters proceed normally. | ||
WBPhenotype:0001151 | Remark | In stu-7/air-2 (RNAi) embryos pronuclear fusion, centrosome duplication and rotation and the nucleation of bipolar microtubule spindle asters proceed normally. | |||
WBPhenotype:0001903 | Remark | The centrosome cycle appears to be unaffected. | |||
Method | RNAi |