WormBase Tree Display for Strain: WBStrain00005280
expand all nodes | collapse all nodes | view schema
| WBStrain00005280 | Status | Live | ||
|---|---|---|---|---|
| Genotype | gcy-35(ok769) I. | |||
| Public_name | CX6448 | |||
| Contains | Gene | WBGene00001555 | ||
| Variation | WBVar00092049 | |||
| Properties | Outcrossed | x6 | ||
| Mutagen | UV+TMP | |||
| CGC_received | 19 Aug 2003 00:00:00 | |||
| Location | CGC | |||
| Made_by | WBPerson3420 | |||
| Remark | 668 bp deletion in cosmid T04D3. Break points are 31961 and 32629 with respect to T04D3. Sequence at break point: CCTGCTCAATGACCTTTATCTTCGTT/AACGTGGCGAACAAAATGGAATCCAACGGT. Primers for a ~2.4kb band in ok769 and a ~3.1kb band in N2: ok769L 5' CCT GGT ACA GTA TTT AGG CG; 3' ok769R 5' CTT TCA GTC CGT TGA GCT TC 3'. | Inferred_automatically | From CGC strain data | |
| Mutagen:UV/TMP | Curator_confirmed | WBPerson1983 | ||
| Species | Caenorhabditis elegans |
