WormBase Tree Display for Strain: WBStrain00027525
expand all nodes | collapse all nodes | view schema
| WBStrain00027525 | Status | Live | ||
|---|---|---|---|---|
| Genotype | nDf53 III; mir-58.1(n4640) IV; nDf54 X. | |||
| Public_name | MT15563 | |||
| Contains | Gene | WBGene00003286 | ||
| Variation | WBVar00323162 | |||
| WBVar00323161 | ||||
| WBVar00090890 | ||||
| Rearrangement | nDf53 | |||
| nDf54 | ||||
| Properties | Outcrossed | x0 | ||
| CGC_received | 21 Feb 2007 00:00:00 | |||
| Location | CGC | |||
| Remark | Sick strain. mir-80 and mir-227 are deleted in nDf53. mir-81, mir-82, T02D1.2 are deleted in nDf54. Deletion breakpoints for n4640 are:CCGGCCAAATCTAGAACTGC / AAGAGTACGGTCTTG...GACTGAGCTAGAGTG / ACCTCTGATAATACGGAACGG. Deletion breakpoints for nDf53 are: ACTCATTTCGTTCGCCAGAAATTC / TCAGTTTGTGTA...ATAGCAGAGGT / ATTAGGAGAGTATAGACATCGAAAGCA. Deletion breakpoints for nDf54 are AAAATTTTTAAATTCTGAAATTAG / TTAAAAAACTGG...ATGAGTGGCAAA / AACTGATTGTGAGTAATTGTCATCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. | Inferred_automatically | From CGC strain data | |
| Made_by: Horvitz Lab | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
