Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Strain: WBStrain00039809

expand all nodes | collapse all nodes | view schema

Name Class

WBStrain00039809StatusLive
GenotypeWhole-genome sequenced strain.
Public_nameVC40842
ContainsGeneWBGene00002150
WBGene00012089
Variation (658)
PropertiesOutcrossedx0
MutagenEMS+ENU
CGC_received21 Mar 2012 00:00:00
05 Nov 2019 00:00:00
LocationCGC
RemarkThis strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.Paper_evidenceWBPaper00042537
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/).Inferred_automaticallyFrom CGC strain data
Made_by: Vancouver KO GroupCGC_data_submission
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5171 mutation is G->A, flanking sequences CTCTGATAATAAAACATTTGTAAAGTGTTC and AATGATATTTTTCGTTGCAGATTGTTTTTT. The gk5172 mutation is T->C, flanking sequences GACGCTTTCCACCACTCCTTCCAAAATTGC and GAAAATTTGAAAACATTTGGATTTTCTATT.Inferred_automaticallyFrom CGC strain data
SpeciesCaenorhabditis elegans