WormBase Tree Display for Strain: WBStrain00051901

WBStrain00051901 Status: Live
  Genotype: stip-1(gk5457[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II.
  Public_name: RG5006
  Contains: Gene: WBGene00001072
      WBGene00003514
      WBGene00004496
      WBGene00006787
      WBGene00006789
      WBGene00007412
    Variation: WBVar00142982
      WBVar00143214
    Rearrangement: mnC1
    Transgene: WBTransgene00024167
  Properties: Mutagen: CRISPR_Cas9
    CGC_received: 01 Sep 2021 00:00:00
  Location: CGC
  Remark: umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5457 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4376 and CGC48. gk5457 is a 3229 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTGGTGCCATTGGTGGTGGTGGAGCCATTG; Right flanking sequence: TTTGGCTGCATGTTGTTTAGTGGCATGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. Inferred_automatically: From CGC strain data
    Made_by: Morgan Zaic CGC_data_submission
  Species: Caenorhabditis elegans