WormBase Tree Display for Variation: WBVar00000083

WBVar00000083 Evidence: Paper_evidence: WBPaper00002920
  Name: Public_name: ad1051
    Other_name: CE25076:p.Trp312Ter
      CE13573:p.Trp133Ter
      R11G10.1b.1:c.399G>A
      R11G10.1a.1:c.936G>A
    HGVSg: CHROMOSOME_V:g.13501125C>T
  Sequence_details: SMap: S_parent: Sequence: T10G3
    Flanking_sequences: tagtgtacaactgacattccgtgagagttg gtcgataagagactcagcttcggagtgaaa
    Mapping_target: T10G3
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00002920
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (12)
    Laboratory: DA
    Status: Live
  Affects: Gene: WBGene00000233
    Transcript: R11G10.1b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: R11G10.1b.1:c.399G>A
        HGVSp: CE13573:p.Trp133Ter
        cDNA_position: 473
        CDS_position: 399
        Protein_position: 133
        Exon_number: 4/7
        Codon_change: tgG/tgA
        Amino_acid_change: W/*
      R11G10.1a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: R11G10.1a.1:c.936G>A
        HGVSp: CE25076:p.Trp312Ter
        cDNA_position: 1029
        CDS_position: 936
        Protein_position: 312
        Exon_number: 6/9
        Codon_change: tgG/tgA
        Amino_acid_change: W/*
    Interactor: WBInteraction000500426
      WBInteraction000557980
      WBInteraction000557981
      WBInteraction000557983
  Genetics: Interpolated_map_position: V 5.36893
  Description (2)
  Reference (11)
  Remark: The correct genotype of the DA1316 strain is avr-14(ad1305) I; avr-15(vu227) glc-1(pk54) V. This strain was incorrectly annotated as avr-14(ad1302) I; avr-15(ad1051) glc-1(pk54) V. when submitted to the CGC.
    The correct genotype of the DA1370 strain is avr-15(vu227) glc-1(pk54) V. This strain was incorrectly annotated as avr-15(ad1051) glc-1(pk54) V. when submitted to the CGC.
  Method: Substitution_allele