WormBase Tree Display for Variation: WBVar00000158
expand all nodes | collapse all nodes | view schema
WBVar00000158 | Name (3) | ||||||
---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | T22E5 | |||
Flanking_sequences | aatctcctaaatttcggtatttaaaatgtt | cctcaaaaatatttttcatgtggctaatac | |||||
Mapping_target | T22E5 | ||||||
Type_of_mutation | Substitution | a | c | Author_evidence | Jakubowski J | ||
SeqStatus | Sequenced | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | WU | ||||||
Detection_method | [Jakuboswki J] DNA Sequencing | ||||||
Positive_clone | T22E5 | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001622 | |||||
Transcript | T22E5.2a.1 | VEP_consequence | 3_prime_UTR_variant | ||||
VEP_impact | MODIFIER | ||||||
HGVSc | T22E5.2a.1:c.*296A>C | ||||||
cDNA_position | 1804 | ||||||
Exon_number | 12/12 | ||||||
Genetics | Interpolated_map_position | X | -2.91921 | ||||
Mapping_data | Multi_point | 3849 | |||||
Remark | [Jakubowski J ] Single nucleotide polymorphism (A to C) at position 22809 of cosmid T22E5 (bases following polymorphism: CCTCAAAAATA) | ||||||
[WU ] Map = X | |||||||
[201021 pad] Generated flanks around position 22809 of the T22E5 clone which is an A. | |||||||
Method | Substitution_allele |