WormBase Tree Display for Variation: WBVar00000219

WBVar00000219 Evidence: Paper_evidence: WBPaper00005525
  Name: Public_name: ar171
    Other_name: F35H12.3.1:c.675G>A
      CE24946:p.Trp225Ter
    HGVSg: CHROMOSOME_X:g.916967G>A
  Sequence_details: SMap: S_parent: Sequence: F35H12
    Flanking_sequences: tgtggtttgtgctgtttgttatctcggtttg gatctggttgccgtgctcacaccaaaagga
    Mapping_target: F35H12
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00002285
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00008024
    Laboratory: GS
    Status: Live
  Affects: Gene: WBGene00004769
    Transcript: F35H12.3.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F35H12.3.1:c.675G>A
        HGVSp: CE24946:p.Trp225Ter
        cDNA_position: 682
        CDS_position: 675
        Protein_position: 225
        Exon_number: 5/9
        Codon_change: tgG/tgA
        Amino_acid_change: W/*
    Interactor (21)
  Genetics: Interpolated_map_position: X -18.9323
  Description: Phenotype: WBPhenotype:0000007 Paper_evidence: WBPaper00005802
        Curator_confirmed: WBPerson712
        Remark: sel-12 mutants have an Egl phenotype and die from eggs hatching in their bodies without using 5-fluorodeoxyuridine. Paper_evidence: WBPaper00005802
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00005802
            Curator_confirmed: WBPerson712
      WBPhenotype:0000461 Paper_evidence: WBPaper00005802
        Curator_confirmed: WBPerson712
        Remark: sel-12(ar171)unc-1(e538) showed an increased survival rate in the presence of 5 mM paraquat, and its survival rate at the fifth day after exposure to paraquat was significantly elevated compared with that of unc-1(e538), whereas the survival rate of sel-12(ar131) showed no significant change from that of unc-1(e538). unc-1 was used as a mutant marker. Experiments were done in the presence of 5-fluorodeoxyuridine to avoid bagging. Paper_evidence: WBPaper00005802
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00005802
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00002747 Paper_evidence: WBPaper00005802
              Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: unc-1(e538) Paper_evidence: WBPaper00005802
              Curator_confirmed: WBPerson712
      WBPhenotype:0000640 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: 100% Egl, ar171/Df similar, W225op Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
        Penetrance: Incomplete: Person_evidence: WBPerson261
              Curator_confirmed: WBPerson712
      WBPhenotype:0001918 Paper_evidence: WBPaper00005802
        Curator_confirmed: WBPerson712
        Remark: sel-12(ar171)unc-1(e538) showed elevated resistance to hydrogen peroxide compared with that of unc-1(e538). unc-1 was used as a mutant marker. Experiments were done in the presence of 5-fluorodeoxyuridine to avoid bagging. Paper_evidence: WBPaper00005802
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00005802
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00001695 Paper_evidence: WBPaper00005802
              Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: unc-1(e538) Paper_evidence: WBPaper00005802
              Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0001660 Paper_evidence: WBPaper00006052
        Curator_confirmed: WBPerson2021
        Remark: No disruption of ASE asymmetry (as seen with lim-6, gcy-7 and gcy-5 reporters) Paper_evidence: WBPaper00006052
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Genotype: otIs114, otIs6, otIs3, ntIs1 Paper_evidence: WBPaper00006052
              Curator_confirmed: WBPerson2021
  Reference: WBPaper00006052
    WBPaper00005802
    WBPaper00019154
    WBPaper00017857
    WBPaper00018436
  Method: Substitution_allele