WormBase Tree Display for Variation: WBVar00000463
expand all nodes | collapse all nodes | view schema
WBVar00000463 | Evidence | Paper_evidence | WBPaper00001677 | |||||
---|---|---|---|---|---|---|---|---|
Name (3) | ||||||||
Sequence_details | SMap | S_parent | Sequence | F02A9 | ||||
Flanking_sequences | attgatgaattggaccggaatggtatgact | cattgatgctagtagcacgtgaactcggaa | ||||||
Mapping_target | F02A9 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001677 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00005672 | |||||||
WBStrain00031270 | ||||||||
WBStrain00052426 | ||||||||
Laboratory | SS | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001609 | ||||||
Transcript | F02A9.6.1 (12) | |||||||
Interactor (14) | ||||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | III | 0.163974 | |||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00040544 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | temperature-sensitive mutation that causes embryonic lethality at its restrictive temperature | Paper_evidence | WBPaper00040544 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00040544 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000061 | Paper_evidence | WBPaper00046170 | ||||||
Curator_confirmed | WBPerson5092 | |||||||
Remark | In analysis of glp-1(bn18), both N2 and glp-1 animals were upshifted from 15 to 25 degrees Celsius from the mid-L1 stage until the first day of adulthood, then we analysed lifespan at 20 degrees Celsius. | Paper_evidence | WBPaper00046170 | |||||
Curator_confirmed | WBPerson5092 | |||||||
WBPhenotype:0000315 | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals had a lower arousal threshold to mechanosensory stimuli than control animals; animals responded more frequently to stimuli than control quiescent animals. | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 24 | Paper_evidence | WBPaper00038400 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000641 | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited increased basal locomotion activity, twice the number of body bends per minute than observed for control animals. | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 24 | Paper_evidence | WBPaper00038400 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00040544 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00040544 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001408 | Paper_evidence | WBPaper00034719 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Nuclear METT-10 is uniformly detected in distally located meiotic nuclei in shifted glp-1(bn18) animals in which almost all germ cells have entered meiosis | Paper_evidence | WBPaper00034719 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00034719 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00034719 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001524 | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited increased L4/A quiescence compared to control animals. Expression of GLP-1(IC) in ciliated neurons partially restored quiescence in glp-1(tslf) animals. | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 24 | Paper_evidence | WBPaper00038400 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000412 | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals responded robustly to octanol. | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00001966 | Paper_evidence | WBPaper00038400 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 24 | Paper_evidence | WBPaper00038400 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038400 | |||||||
WBPaper00040544 | ||||||||
WBPaper00034719 | ||||||||
WBPaper00046170 | ||||||||
WBPaper00061946 | ||||||||
WBPaper00064401 | ||||||||
Remark | A1034T, intracellular domain | |||||||
Method | Substitution_allele |