WormBase Tree Display for Variation: WBVar00000610
expand all nodes | collapse all nodes | view schema
WBVar00000610 | Evidence | Paper_evidence | WBPaper00027335 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | bx132 | |||||||
Other_name | CE42345:p.Arg509Ter | ||||||||
CE27581:p.Arg523Ter | |||||||||
C39F7.2a.1:c.1567C>T | |||||||||
C39F7.2b.1:c.1525C>T | |||||||||
HGVSg | CHROMOSOME_V:g.1226033G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C39F7 | |||||
Flanking_sequences | aacaactcggttactgtagtctggaggcct | gaaatgacggaagcgcagttgatggattcg | |||||||
Mapping_target | C39F7 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00027335 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007190 | ||||||||
Laboratory | EM | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00016539 | |||||||
Transcript | C39F7.2a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C39F7.2a.1:c.1567C>T | ||||||||
HGVSp | CE27581:p.Arg523Ter | ||||||||
cDNA_position | 1578 | ||||||||
CDS_position | 1567 | ||||||||
Protein_position | 523 | ||||||||
Exon_number | 10/15 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
C39F7.2b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C39F7.2b.1:c.1525C>T | ||||||||
HGVSp | CE42345:p.Arg509Ter | ||||||||
cDNA_position | 1546 | ||||||||
CDS_position | 1525 | ||||||||
Protein_position | 509 | ||||||||
Exon_number | 9/14 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Genetics | Interpolated_map_position | V | -19.8477 | ||||||
Description | Phenotype | WBPhenotype:0000227 | Paper_evidence | WBPaper00027335 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00027335 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Ray 1 axon. | Paper_evidence | WBPaper00027335 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000470 | Paper_evidence | WBPaper00038152 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00038152 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00038152 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00027335 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Ray 1 axon. | Paper_evidence | WBPaper00027335 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00027335 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00027335 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00027335 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Lateral to ventral ray axon outgrowth abnormal. | Paper_evidence | WBPaper00027335 | ||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001227 | Paper_evidence | WBPaper00027335 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Ray axons: R1, R2/3, R4/5. | Paper_evidence | WBPaper00027335 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00027335 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Range | 9 | 54 | Paper_evidence | WBPaper00027335 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001239 | Paper_evidence | WBPaper00027335 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0002490 | Paper_evidence | WBPaper00027335 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Ray 1 axon | Paper_evidence | WBPaper00027335 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006942 | PATO:0000460 | Paper_evidence | WBPaper00027335 | ||||
Curator_confirmed | WBPerson48 | ||||||||
GO_term | GO:0030424 | PATO:0000460 | Paper_evidence | WBPaper00027335 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_not_observed | WBPhenotype:0000882 | Paper_evidence | WBPaper00027335 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Formation of ray dendrites is normal. | Paper_evidence | WBPaper00027335 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Reference | WBPaper00038152 | ||||||||
WBPaper00027335 | |||||||||
Method | Substitution_allele |