WormBase Tree Display for Variation: WBVar00054172

WBVar00054172 Evidence: Paper_evidence: WBPaper00005973
  Name: Public_name: ch4
    Other_name: CE20530:p.Lys125_Ter185delextTer?
      C27A12.5.1:c.373_555del
    HGVSg: CHROMOSOME_I:g.6047108_6049421del
  Sequence_details: SMap: S_parent: Sequence: C27A12
    Flanking_sequences: acagctgggctctttcttcaacctctccga ttggaaggatcaggtgagctatttaattaa
    Mapping_target: C27A12
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00034654
      WBStrain00034655
    Laboratory: TB
    Status: Live
  Affects: Gene: WBGene00196480
      WBGene00000429
    Transcript: C27A12.5.1 (11)
      C27A12.11 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
    Interactor: WBInteraction000503047
  Genetics: Interpolated_map_position: I 0.702503
    Mapping_data: In_multi_point: 4201
  Reference: WBPaper00011600
  Remark: Flanking sequences are 30 bp to the left of K(125) and to the right of R(185) Curator_confirmed: WBPerson1845
    ch4 is a 2.5 kb deletion that deletes the HD domain Paper_evidence: WBPaper00005973
  Method: Deletion_allele