WormBase Tree Display for Variation: WBVar00066294
expand all nodes | collapse all nodes | view schema
| WBVar00066294 | Name | Public_name | cxTi4018 | ||
|---|---|---|---|---|---|
| Sequence_details | SMap | S_parent | Sequence | F32H2 | |
| Flanking_sequences | gaactgcaatggacttcaaggatttgtaat | atttcattcatttggaggaggaactggatc | |||
| Mapping_target | F32H2 | ||||
| Type_of_mutation | Insertion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Transposon_insertion | Tc3 | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00024648 | ||||
| Laboratory | IE | ||||
| NemaGENETAG_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00006532 | |||
| Transcript | F32H2.9.1 | ||||
| Interactor | WBInteraction000504817 | ||||
| Description (2) | |||||
| Reference | WBPaper00036195 | ||||
| Remark | [20051214 db] renamed from cxP4018 | ||||
| [20060511 db] removed by request of Segalat lab; Tc insertion could not be recovered | |||||
| Resurrected | |||||
| Method | NemaGENETAG_consortium_allele |
