WormBase Tree Display for Variation: WBVar00087793
expand all nodes | collapse all nodes | view schema
WBVar00087793 | Name | Public_name | hc104 | ||||
---|---|---|---|---|---|---|---|
Other_name | CE37870:p.Arg115Ter | ||||||
AC3.10.1:c.343C>T | |||||||
AC3.10.2:c.343C>T | |||||||
HGVSg | CHROMOSOME_V:g.10384739C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | AC3 | |||
Flanking_sequences | ttgaaagcagtcacaccgatggagaaaaat | gatacgtggtagagaaatcgacacctgaac | |||||
Mapping_target | AC3 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00026789 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00000373 | ||||||
WBStrain00000374 | |||||||
WBStrain00000383 | |||||||
WBStrain00000386 | |||||||
Laboratory | BA | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00004964 | |||||
Transcript | AC3.10.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | AC3.10.1:c.343C>T | ||||||
HGVSp | CE37870:p.Arg115Ter | ||||||
cDNA_position | 391 | ||||||
CDS_position | 343 | ||||||
Protein_position | 115 | ||||||
Exon_number | 4/7 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
AC3.10.2 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | AC3.10.2:c.343C>T | ||||||
HGVSp | CE37870:p.Arg115Ter | ||||||
cDNA_position | 369 | ||||||
CDS_position | 343 | ||||||
Protein_position | 115 | ||||||
Exon_number | 3/6 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
Genetics | Interpolated_map_position | V | 2.54027 | ||||
Mapping_data | In_multi_point | 1191 | |||||
2133 | |||||||
2134 | |||||||
In_pos_neg_data | 4769 | ||||||
4770 | |||||||
4771 | |||||||
4772 | |||||||
4773 | |||||||
4774 | |||||||
Description | Phenotype | WBPhenotype:0000670 | Person_evidence | WBPerson261 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Hermaphrodites and males produce nonfunctional but motile sperm with short pseudopods. Difficult to score (ES2) in adult. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Ease_of_scoring | ES2_Difficult_to_score (2) | ||||||
WBPhenotype:0001344 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | severe defects in fibrous body-membranous organelle. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001727 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Wild-type N2 animals had an average length of 1222 μm and width of 78 μm (Additional file 6). Mutants for spe-10(hc104) showed an increased width to 85-90 μm. | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Table 2, Additional file 13A | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0000315 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Additional file 12 | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Animals did not show a significant difference in age-related decline of thrashing rate, compared to wild type (N2) controls (Additional file 9) | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0001700 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Figure 3 A-B | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0001726 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Wild-type N2 animals had an average length of 1222 μm and width of 78 μm (Additional file 6). Mutants for spe-10(hc104) showed no significant changes in body length. | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00045834 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Additional file 8 | Paper_evidence | WBPaper00045834 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Reference | WBPaper00045834 | ||||||
Method | Substitution_allele |