WormBase Tree Display for Variation: WBVar00087793
expand all nodes | collapse all nodes | view schema
| WBVar00087793 | Name | Public_name | hc104 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | CE37870:p.Arg115Ter | ||||||
| AC3.10.1:c.343C>T | |||||||
| AC3.10.2:c.343C>T | |||||||
| HGVSg | CHROMOSOME_V:g.10384739C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | AC3 | |||
| Flanking_sequences | ttgaaagcagtcacaccgatggagaaaaat | gatacgtggtagagaaatcgacacctgaac | |||||
| Mapping_target | AC3 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00026789 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00000373 | ||||||
| WBStrain00000374 | |||||||
| WBStrain00000383 | |||||||
| WBStrain00000386 | |||||||
| Laboratory | BA | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00004964 | |||||
| Transcript | AC3.10.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | AC3.10.1:c.343C>T | ||||||
| HGVSp | CE37870:p.Arg115Ter | ||||||
| cDNA_position | 391 | ||||||
| CDS_position | 343 | ||||||
| Protein_position | 115 | ||||||
| Exon_number | 4/7 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| AC3.10.2 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | AC3.10.2:c.343C>T | ||||||
| HGVSp | CE37870:p.Arg115Ter | ||||||
| cDNA_position | 369 | ||||||
| CDS_position | 343 | ||||||
| Protein_position | 115 | ||||||
| Exon_number | 3/6 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| Genetics | Interpolated_map_position | V | 2.54027 | ||||
| Mapping_data | In_multi_point | 1191 | |||||
| 2133 | |||||||
| 2134 | |||||||
| In_pos_neg_data | 4769 | ||||||
| 4770 | |||||||
| 4771 | |||||||
| 4772 | |||||||
| 4773 | |||||||
| 4774 | |||||||
| Description | Phenotype | WBPhenotype:0000670 | Person_evidence | WBPerson261 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Hermaphrodites and males produce nonfunctional but motile sperm with short pseudopods. Difficult to score (ES2) in adult. | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001344 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | severe defects in fibrous body-membranous organelle. | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001727 | Paper_evidence | WBPaper00045834 | |||||
| Curator_confirmed | WBPerson2987 | ||||||
| Remark | Wild-type N2 animals had an average length of 1222 μm and width of 78 μm (Additional file 6). Mutants for spe-10(hc104) showed an increased width to 85-90 μm. | Paper_evidence | WBPaper00045834 | ||||
| Curator_confirmed | WBPerson2987 | ||||||
| Phenotype_not_observed (6) | |||||||
| Reference | WBPaper00045834 | ||||||
| Method | Substitution_allele |
