WormBase Tree Display for Variation: WBVar00088064
expand all nodes | collapse all nodes | view schema
WBVar00088064 | Evidence | Paper_evidence | WBPaper00003757 | ||
---|---|---|---|---|---|
Name | Public_name | jd16 | |||
Other_name | F26C11.2.1:c.501+1G>A | ||||
HGVSg | CHROMOSOME_II:g.9898212C>T | ||||
Sequence_details | SMap | S_parent | Sequence | F26C11 | |
Flanking_sequences | aaggatgatggagaacaaatggaaacaaaa | tgagattttaagaaattattttattaaaag | |||
Mapping_target | F26C11 | ||||
Type_of_mutation | Substitution | g | a | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Laboratory | ER | ||||
Status | Live | ||||
Affects | Gene | WBGene00006744 | |||
Transcript | F26C11.2.1 | VEP_consequence | splice_donor_variant | ||
VEP_impact | HIGH | ||||
HGVSc | F26C11.2.1:c.501+1G>A | ||||
Intron_number | 5/7 | ||||
Genetics | Interpolated_map_position | II | 1.7696 | ||
Reference | WBPaper00003757 | ||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006744 Donor | ||||
Method | Substitution_allele |