WormBase Tree Display for Variation: WBVar00088126

WBVar00088126 Evidence: Paper_evidence: WBPaper00005015
    CGC_data_submission
  Name: Public_name: js379
    Other_name (26)
    HGVSg: CHROMOSOME_V:g.18496040C>T
  Sequence_details: SMap: S_parent: Sequence: Y51A2D
    Flanking_sequences: cttcgcctcatgaccgtacccgacattcta agtacctcaacatcctgaaaacatcttcat
    Mapping_target: Y51A2D
    Type_of_mutation: Substitution: c t
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (14)
    Laboratory: NM
    Status: Live
  Affects: Gene: WBGene00004830
    Transcript (13)
  Genetics: Interpolated_map_position: V 16.7431
  Description: Phenotype (14)
    Phenotype_not_observed: WBPhenotype:0000646 Paper_evidence: WBPaper00038239
        Curator_confirmed: WBPerson712
        Remark: slo-1(js379) mutants move with similar speed compared with wild-type C. elegans. Paper_evidence: WBPaper00038239
            Curator_confirmed: WBPerson712
      WBPhenotype:0000845 Paper_evidence: WBPaper00031895
        Curator_confirmed: WBPerson712
        Remark: As measured by the fraction of animals moving over time on NGM plate containing 400uM levamisole, recorded by the Parallel Worm Tracker. Paper_evidence: WBPaper00031895
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00031895
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00004019 Paper_evidence: WBPaper00031895
              Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000063 PATO:0000460 Paper_evidence: WBPaper00031895
                Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Synchronized populations of animals were cultivated at 20C on NGM agar containing OP50. Worms washed in normal physiological saline were transferred to the assay plate in a manner to avoid scratching the surface of the drug containing agar plate.~25 worms were transferred/plate. Worms were confined to the field of view of the tracker by using a corral of copper chloride (see paper for details). Paper_evidence: WBPaper00031895
              Curator_confirmed: WBPerson712
      WBPhenotype:0001400 Paper_evidence: WBPaper00039987
        Curator_confirmed: WBPerson712
        Remark: Western blot analysis reveals no difference in total SLO-1::GFP protein between WT and DAPC(lf) mutants. Paper_evidence: WBPaper00039987
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: cimIs1[slo-1a::GFP,rol-6(d)] Paper_evidence: WBPaper00039987
              Curator_confirmed: WBPerson712
      WBPhenotype:0001403 Paper_evidence: WBPaper00039987
        Curator_confirmed: WBPerson712
        Remark: UNC-38 and ACR-16 were clustered along the nerve cord, similar to WT. Paper_evidence: WBPaper00039987
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: acr-16(ok789); jaSi4[Pmyo-3:acr-16::gfp] Paper_evidence: WBPaper00039987
              Curator_confirmed: WBPerson712
      WBPhenotype:0001703 Paper_evidence: WBPaper00038239
        Curator_confirmed: WBPerson712
        Remark: slo-1(js379) mutants move with similar frequency of body bends compared with wild-type C. elegans. Paper_evidence: WBPaper00038239
            Curator_confirmed: WBPerson712
  Reference: WBPaper00038239
    WBPaper00039987
    WBPaper00040570
    WBPaper00036766
    WBPaper00031895
    WBPaper00046360
    WBPaper00056003
  Method: Substitution_allele