WormBase Tree Display for Variation: WBVar00088136
expand all nodes | collapse all nodes | view schema
WBVar00088136 | Name | Public_name | ju2 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F35D2.5a.1:c.1471C>T | ||||||||
CE33391:p.Arg491Ter | |||||||||
F35D2.5c.2:c.673C>T | |||||||||
F35D2.5c.1:c.673C>T | |||||||||
CE33392:p.Arg225Ter | |||||||||
HGVSg | CHROMOSOME_II:g.7588281G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | R07G3 | |||||
Flanking_sequences | taaacttttttgttttcagagcaacaattt | gattgtctaatggaagtccgggaagaactg | |||||||
Mapping_target | R07G3 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00005543 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CZ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006363 | |||||||
Transcript | F35D2.5c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F35D2.5c.1:c.673C>T | ||||||||
HGVSp | CE33392:p.Arg225Ter | ||||||||
cDNA_position | 676 | ||||||||
CDS_position | 673 | ||||||||
Protein_position | 225 | ||||||||
Exon_number | 6/11 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
F35D2.5a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F35D2.5a.1:c.1471C>T | ||||||||
HGVSp | CE33391:p.Arg491Ter | ||||||||
cDNA_position | 1475 | ||||||||
CDS_position | 1471 | ||||||||
Protein_position | 491 | ||||||||
Exon_number | 14/19 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
F35D2.5c.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F35D2.5c.2:c.673C>T | ||||||||
HGVSp | CE33392:p.Arg225Ter | ||||||||
cDNA_position | 1249 | ||||||||
CDS_position | 673 | ||||||||
Protein_position | 225 | ||||||||
Exon_number | 11/16 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Interactor (20) | |||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00005543 | |||||
Genetics | Interpolated_map_position | II | 0.504799 | ||||||
Mapping_data | In_multi_point | 4715 | |||||||
Description | Phenotype | WBPhenotype:0000566 | Paper_evidence | WBPaper00005543 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | syd-1 mutant animals coiled ventrally when they moved backwards. | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000847 | Paper_evidence | WBPaper00005543 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | There were fewer ventral SNB-1::GFP puncta in mutants than in wild-type animals, and they were slightly irregular in shape. In dorsal cords, the number of puncta was comparable to wild type; however the puncta shape were noticeably abnormal. | In syd-1 mutants, only 3-7 SNB::GFP puncta in ASI axons were observed and distinct SNB::GFP puncta in dendritic regions were detected. | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005666 | PATO:0000460 | Paper_evidence | WBPaper00005543 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005300 | PATO:0000460 | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006750 | PATO:0000460 | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | juIs1[Punc-25::SNB-1::GFP] | Paper_evidence | WBPaper00005543 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00005543 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The overall morphology of DDs and VDs was normal; however, mild abnormalities in ASI were observed, where a single process first emerged from the cell bodies and later branched to form an axon and dendrite, and the axon extended farther posteriorly before looping into the nerve ring. | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005666 | PATO:0000460 | Paper_evidence | WBPaper00005543 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001801 | Paper_evidence | WBPaper00005543 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | syd-1 affects the polarity of ASI neurons. | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005666 | PATO:0000460 | Paper_evidence | WBPaper00005543 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002232 | Paper_evidence | WBPaper00005543 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Polarity of L1 DDs is disrupted in the same way as in the adult VDs in syd-1 mutants; however despite initial polarity defects in juvenile DDs, the polarity of adult DDs seems normal in syd-1 mutants. | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00005543 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00005543 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed (2) | |||||||||
Reference | WBPaper00005543 | ||||||||
Remark | Flanking sequences refer to F35D2.5c isoform | Curator_confirmed | WBPerson1845 | ||||||
Method | Substitution_allele |